Gene targeting vectors are designed with this in mind. Additionally, a self-removing selection cassette circumvents the need to breed to Flp deleter mice. Dalhousie University. Because each style has its own formatting nuances that evolve over time and not all information is available for every reference entry or article, Encyclopedia.com cannot guarantee each citation it generates. Publisher’s Note. 0000006551 00000 n
Alternative splicing generates multiple transcript and protein isoforms from a single gene and controls transcript intracellular localization and stab %PDF-1.4
%����
Gene Targeting. Within the “Cite this article” tool, pick a style to see how all available information looks when formatted according to that style. Here, we describe a highly efficient GT … Note: Content may be edited for style … It is hoped that gene targeting may eventually become useful in treating some human genetic disorders such as hemophilia and Duchenne muscular dystrophy. "Its impact on the understanding of gene function and its benefits to mankind will continue to increase over many years to come." Note: Selection marker for gene targeting is generally not required for animal model generation using CRISPR-based EGE™, in contrast to ESC/HR technology. Human ESCs and iPSCs from confluent wells were plated into two wells at a high density (2×) of ∼2.8 × 10 5 … xref
Pick a style below, and copy the text for your bibliography. 0000012491 00000 n
S2). Two loci could be identified that had been assigned GenBank ac-cession numbers XM_748769 (Ku70) and XM_744304 (Ku80).
At first glance, this hardly seems favorable given that in A. nidulans non … This permits the introduction of a mutation into specific cellular genes, which can either stop the gene functioning altogether (called a "knock out ") or can mimic changes to genes that have been implicated in human diseases. 0000002456 00000 n
Gene targeting requires the creation of a spe… However, targeting … However, the methods described in plants … It is important to note that the effector of this system remains Cre recombinase, such that all previously generated conventional loxP alleles can be usefully … Technologies also now exist that allow genes to be removed not just in a whole animal, as described above, but in a subset of cells or in a particular tissue. However, production of gene targeted transgenic (GTT) rabbits has been an extreme challenge. . Notes † Reference(s) ... C Deng, M.R CapecchiReexamination of gene targeting frequency as a function of the extent of homology between the targeting vector and the target locus. 752 0 obj<>stream
It was based on the … p52 ; wu:fa04h09; zgc:77721; Type protein_coding_gene Location Chr: 19 Mapping Details/Browsers Description Predicted to have double-stranded DNA binding activity. In addition to the MLA, Chicago, and APA styles, your school, university, publication, or institution may have its own requirements for citations. To date, however, mTOR-targeted therapies in cancer have … Homologous recombination of a DNA vector into a gene of interest can be done in almost any cell type but occurs at a very low frequency, and it is therefore important to detect the few cells that have taken up the gene. The development of nuclear transfer (moving the nucleus from one cell to another), however, has allowed gene targeting to be done in other mammalian species, such as sheep and pigs. Conditions can be a specific time during development / life of the organism or limitation to a specific tissue, for example. To delete a complete gene sequence, delete multicopy family genes, cotarget two different genes or generate specific chromosomal translocations, and to improve the gene targeting efficiency, two (or more) gRNAs can be simultaneously expressed in pLdCN vector (Fig. 0000004101 00000 n
Previous studies using mTOR inhibitors have shown that mTOR targeting suppresses gene expression and cell proliferation. A general method for improving the efficiency of gene targeting … The development of designed site-specific endonucleases boosted the establishment of gene targeting (GT) techniques in a row of different species. Precise bacteriophage P1. Both single-celled and multicellular organisms can be ge…, The transformation of a single-celled zygote (product of the union between egg and sperm) to a multicellular embryo and then to an adult organism is…, Chromosome, Eukaryotic Encyclopedia.com. Fungal strains deficient in the non-homologous end-joining (NHEJ) pathway are excellent recipient strains for gene targeting approaches. Here, we built homology-independent targeted integration (HITI) CRISPR-Cas9 minicircle donors for precise safe harbor … Laboratory Protocols for Conditional Gene Targeting. Biology Notes 12/01/06 Connection between Genes and Proteins Evidence that genes specify proteins … TestR: 5’‐ATGCCTACAGAAAACAACACACTACA‐3’. This is currently the subject of much research. 0
Genetics. By constructing a sequence that is homologous to a target sequence (such as a gene), laboratory researchers can replace one of the cell's own copies of a particular gene with a copy that has been altered in some way. This allows the function of this gene, which may be required for the mouse to normally develop, to be analyzed in a particular cell type or tissue where only the Cre recombinase is expressed. Title: Gene Targeting 1 (No Transcript) 2 Gene Targeting. 0000011870 00000 n
Scientists have used gene-editing advances to achieve a tenfold increase in the production of super-bug targeting formicamycin antibiotics. %%EOF
A translational bottleneck to using reporter genes is the necessity to engineer cells with randomly integrating vectors. This can be achieved by modifying the vector to include target sites (termed loxP sites) for an enzyme called Cre recombinase. 0000005946 00000 n
Therefore, it’s best to use Encyclopedia.com citations as a starting point before checking the style against your school or publication’s requirements and the most-recent information available at these sites: http://www.chicagomanualofstyle.org/tools_citationguide.html. To compare the gene targeting approach with our previously developed CRISPR-Cas9–mediated gene correction strategy and neonatal gene therapy, we treated p2 spf ash mice with AAV8.SaCas9 in combination with vectors for gene targeting (AAV8.sgRNA1.hOTCco donor), gene correction of the spf ash mutation (AAV8.sRNA1.donor vector), or gene therapy … Then, copy and paste the text into your bibliography or works cited list. If you are not using the MIT Transgenic … 0000012367 00000 n
Meaning of Gene Targeting and Gene Therapy: Gene targeting is a form of in vivo site-directed mutagenesis involving homologous recombination between a targeting vector containing one allele and an endogenous gene … The gene orthologous to the Ku70 subunit-encoding gene In order to make this potential treatment effective it will be necessary to develop technologies that increase the frequency with which targeting occurs. No notes for slide. PSYO 3970 Lecture Notes - Lecture 3: Gene Targeting, Cell Potency. The method can be used to delete a gene, remove exons, add a gene and modify individual base pairs (introduce point mutations). 29/11/ Lecture 31 – Methods in Molecular Genetics III Molecular biology of gene targeting: Last lecture: Serie of experiences that lead to the discovery of a very important family of RNAs called MicroRNA. Gene-targeting components. Note: If you want a transgene targeted to the ROSA26 or H11 loci, please see our Targeted Transgenesis service description. 0000000016 00000 n
0000012615 00000 n
The development of designed site-specific endonucleases boosted the establishment of gene targeting (GT) techniques in a row of different species. Defining Cre activity by 2 distinct gene promoters, rather than 1, confers a substantially greater level of precision in genetic targeting than could be achieved previously with Cre controlled by a single gene promoter. OC2181654. Traditionally, mouse targeting has been done in the 129Sv background, which can be quite different at some loci. Numerous mouse genes have been knocked out with the help of gene targeting, resulting in the production of hundreds of different mouse models of human disorders, including cancer , diabetes, cardiovascular diseases, and neurological disorders. requires that the pieces of DNA undergoing recombination be almost identical (homologous) in sequence. Alyssa, Cameron, and Tony; 3 Gene Targeting (replacement strategy based on homologous recombination) Homologous recombination genetic exchange between two similar strands of DNA ; Endogenous Gene any gene found naturally within an organism; A technique that uses … © 2019 Encyclopedia.com | All rights reserved. Most online reference entries and articles do not have page numbers. ." Gene targeting. X Exclude words from your search Put - in front of a word you … 0000008688 00000 n
Living organisms are divided into two broad categories based upon certain attributes of cell structure. Refer to each style’s convention regarding the best way to format page numbers and retrieval dates. Lecture Notes as per Topics. School. In the second round of PCR, the fusion PCR, the appropriate PCR fragments are fused in two independent reactions that involve primer pairs (U1 and M3) and (M2 and D2) to complete construction of the bipartite gene-targeting … (c) Illustration of biolistic codelivery of the GT vector and additional free DRT followed by plant regeneration and selection. PLEASE NOTE: The mouse sequence in these databases is from a C57BL/6J mouse because this is the mouse strain whose genome was … 0000002177 00000 n
Buy Gene Targeting Protocols (Methods in Molecular Biology) 2000 by Kmiec, Eric B., Gruenert, Dieter C. (ISBN: 9780896033603) from Amazon's Book Store. However, the use of NHEJ-deficient strains can also pose some limitations for gene function … 0000009320 00000 n
David LePage's Gene Targeting Protocols Growing ES Cells Passaging 35 mm Dishes Freezing 35 mm Dishes Preparing Vector DNA Electroporation Picking Lines Tryplating Freezing 96-Well Plates DNA … . Class #3 . Torres, R. M., and R. Kuhn. 0000003051 00000 n
0000004251 00000 n
The first category, th…, A common feature of organisms is that offspring tend to look like their parents. In addition to changing single genes it is also possible to remove or alter large pieces of chromosomes. Targeted gene manipulation is a powerful technique to analyze gene function. Until very recently mice were the only organisms in which it has been possible to introduce targeted mutations into the germ line. Gene targeting allows precise modifications to be made in cells for the functional analysis of a specific gene. Other viruses, such as adenoviruses, introduce their DNA into the nucleus of the cell, but the DNA is not integrated into a chromosome ; Targeted killing of specific cells. This process involves the construction of a piece of DNA, known as a gene targeting vector , which is then introduced into the cell where it replaces or modifies the normal chromosomal gene through the process of … 0000002900 00000 n
(Aand B) Testing I-SceI efficiency ().The reporter constructs were transformed via P elements (indicated by small arrowheads) and carried the I-SceI cut site (as indicated) either (A) adjacent to a shortened version of the wild-typew + gene (indicated by the large solid arrow), or (B) flanked by a complete copy and a nonfunctional partial copy of thatw + gene. As well as mutating or knocking out specific genes, gene targeting allows the introduction of novel pieces of DNA into a specific chromosomal location (this is often termed a "knock-in"). 0000005436 00000 n
Chimeric nucleases (CNs) have the potential to … 0000011448 00000 n
x�b```b``;�������A��b�,K%�99oeX�v@iK�K
����oȔ�,�Ԡ�q@�;_�[���5�����$�2���Q�)G�R�7���t4ۓ_�a��6W���cm�. Note that R1 and R2 are adaptamers. Manipulating the Mouse Embryo: A Laboratory Manual, 2nd ed. PSYO 3970. Once the puromycin resistant cells have been expanded into cell lines, the DNA of these cells can then be analyzed to select out a subset of the cells in which the introduced construct has integrated into the correct (target) gene. Chapter 1 Gene targeting, ... From Gene to Protein - From Gene to Protein Chapter 17 Hon. https://www.encyclopedia.com/medicine/medical-magazines/gene-targeting, "Gene Targeting Rice ( Oryza sativa ), with a sequenced genome of 389 Mb, is one of the most important crops and a model plant for cereals, and the single-copy gene Waxy on chromosome 6 has … "Gene Targeting: A Practical Approach (second edition) is a practical tool and information resource for scientists working on fundamental or applied aspects of gene targeting, ES cell manipulation, and analysis of mouse mutants. Widespread use of both targeted mutagenesis and gene targeting has become possible through the development of programmable nucleases which enable the induction of a precise DSB at a desired position in … Genetics. This allows researchers to examine the function of a gene in a variety of ways. 0000003951 00000 n
. Note … Abstract. This process involves the construction of a piece of DNA, known as a gene targeting vector , which is then introduced into the cell where it replaces or modifies the normal chromosomal gene through the process of homologous recombination. Gene therapy is a new and largely experimental branch of medicine that uses genetic material (DNA) to treat patients. Hogan, B., et al. Cells lacking the pac gene will die in a culture medium containing puromycin. However, the methods described in plants require a highly efficient transformation and regeneration procedure and, therefore, can be applied to very few species. The modification of an endogenous gene into a designed sequence by homologous recombination, termed gene targeting (GT), has broad implications for basic and applied research. This allows the selection of single cells that have incorporated the DNA construct into their own chromosomes. Preview text. 0000004402 00000 n
In the targeted transformants, integration of such fragments into the host chromosome was a rare event. 0000004705 00000 n
Direct cell killing is possible if the inserted … Treating human disease by the types of genetic approaches mentioned above is termed "gene therapy." As well as mutating or knocking out specific genes, gene targeting allows the introduction of novel pieces of DNA into a specific chromosomal location (this is often termed a "knock-in"). startxref
With gene targeting, the uncertainty inherent … Retrieved January 13, 2021 from Encyclopedia.com: https://www.encyclopedia.com/medicine/medical-magazines/gene-targeting. This "selectable marker" gene makes the cells that possess it resistant to antibiotics, and can then be used to eliminate cells that are not genetically modified. 706 47
Gene targeting is now performed regularly in both . Scientists have used gene-editing advances to achieve a tenfold increase in the production of super-bug targeting formicamycin antibiotics. 0000007199 00000 n
Department. 2 strain backgrounds. Gene Targeting in Plants via Site-Directed Mutagenesis / Peter B. Kipp, Joyce M. Van Eck and Peter R. Beetham / [et al.] 0000015533 00000 n
ervt/lreum Plasmid Transformation Selection" (origin)' frequency pIJlOl (S. /iv'idans) pIJ303 103 tsr pIJ364 103 tsr i,ph pIJ424 103 tsr (aphIl, promoter probe) p1J425 103 tsr (aphll, promoter probe) plJ486 <10 tsr (aphill, promoter probe) plJ487 <10 tsr (tipill, promoter probe) pIJ643 103 tsr vp/1 plJ680 <10 tsr aphl p1J697 … "Gene targeting in mice has pervaded all fields of biomedicine," it said. Potential cloning vectors forA. Transgenic animal = a foreign gene … 0000010031 00000 n
Gene targeting (also, replacement strategy based on homologous recombination) is a genetic technique that uses homologous recombination to modify an endogenous gene.The method can be used to delete a gene, remove exons, add a gene and modify individual base pairs (introduce point mutations).Gene targeting can be permanent or conditional. 49. Efficiency of gene targeting was increased more than 10-fold when an excess molar ratio of non-homologous fragments was added in the transformation of Aspergillus nidulans. Imaging reporter genes provides longitudinal information on the biodistribution, growth, and survival of engineered cells in vivo. 19 views 2 pages. The earliest method scientists used to edit genomes in living cells was homologous recombination. Everyday low prices and free delivery on eligible orders. Homologous DNA recombination (HR) allows the deletion (knockout), repair (rescuing), and modification of a selected gene, thereby rendering a functional analysis of the gene product possible. This experimental approach is termed gene targeting (GT) and can be used to perform amino acid exchanges or to guide a transgene to a desired position within the genome [3]. 0000003201 00000 n
For gene targeting in gram-negative bacteria, we constructed the broad-host-range targetron donor plasmid pBL1 ... A cautionary note is that while mobile group II introns containing a Kan r retrotransposition-activated marker gene (also known as a retrotransposition indicator gene) function well when expressed in E. coli with a T7 promoter or in L. lactis with a nisin-inducible … Gene targeting is the process of disrupting or mutating a specific genetic locus in embryonic stem (ES) cells, usually with the intention of making knock-out or knock-in mice. Homologous recombination is a process that occurs within the chromosome and which allows one piece of DNA to be exchanged for another piece. However, the fairly low efficiency of traditional gene targeting has limited the utility of gene targeting in the study of gene function. It is a cellular mechanism that is probably part of the normal process cells use to repair breaks in their chromosomes. 0000012119 00000 n
Mutants were obtained with both modified versions of the Red-mediated gene targeting method, but no mutants were obtained with the original version of the Red-mediated gene inactivation method Although APEC1 showed a 5-times higher number of transformants with the plasmid pEHEC356 than E. coli UTI89, this did not lead to a 5-times larger number of … pathway on gene targeting in the opportunistic pathogen As-pergillus fumigatus, we screened the annotated genome for deduced sequences similar to either of the Ku subunits. 0000012243 00000 n
Therefore, an increase in the efficiency of gene targeting will have an impact on the production of genetically engineered … CrossRef View Record in Scopus Google Scholar. The stem cells can then be differentiated into the affected cell type (for example, into bone marrow cells for hemophilia) and these cells could then be transplanted to patients. Gene targeting—the process of gene replacement by homologous recombination—is a very useful but typically inefficient technique ( [1][1] ). 1. Additional file 1: Figure S1. New York: Oxford University Press, 1997. Supplementary information. ZDB-GENE-030131-6779 Name general transcription factor IIH, polypeptide 4 Symbol gtf2h4 Nomenclature History Previous Names. Only the relevant part of pDEL1 is shown including the position of the direct repeats, DR, and the pyr-4 marker gene. Antisense Oligonucleotides as Modulators of Pre-mRNA Splicing / Halina … Correction of gene defects in human somatic cells by targeting as has been used in murine embryonic stem cells (1, 2) has been precluded by the low spontaneous rate of gene targeting ().However, creation of a DNA double-stranded break (DSB) in the genomic target (DSB-GT) can stimulate homologous recombination by over 1000-fold ().We can rapidly and quantitatively measure gene targeting … 0000011746 00000 n
0000008124 00000 n
If two chromosomes break and … 0000004857 00000 n
The original chromosomes recombine, so that each now carries … This general approach is popular in cancer gene therapies. Everyday low prices and free delivery on eligible orders. Because CF lung disease is currently the major cause of mortality and morbidity, and the lung airway is readily accessible to gene delivery, the major CF gene therapy effort at present is directed to the lung. An example of a selectable marker that is commonly used for this purpose is the puromycin-N-acetyl-transferase (pac ) gene, which confers resistance to the antibiotic puromycin, a drug that inhibits the function of ribosomes . 18 Sep 2018. Gene Targeting The Gene Targeting Facility is a centralized facility for the production of gene-targeted mice. 0000006474 00000 n
"Gene Targeting Gene targeting is a method for modifying the structure of a specific gene without removing it from its natural environment in the chromosome in a living cell. Gene targeting (also, replacement strategy based on homologous recombination) is a genetic technique that uses homologous recombination to modify an endogenous gene. Creation of transgenic animals with selective inactivation of one of their specific genes has been widely used in the last two decades to study the role of genes. In addition, NHEJ-deficiency can facilitate the formation of heterokaryons which allows rapid identification of essential genes. 254tutnotes - tutorial FDSC 442 Course Outline 9.9 notes BIOL 200 Final Notes Lecture 30 – Emerging roles for RNAs Final Exam Lectures. Gene targeting with homologous recombination in embryonic stem cells created a revolution in the analysis of the function of genes in behavioral brain research. Adv. Homologous recombination is the exchange (recombination) of genetic information between two similar (homologous) strands of DNA.1Scientists began developing this technique in the late 1970s following observations that yeast, like other organisms, can carry out homologous recombination naturally. Predicted to be involved in nucleotide-excision repair and phosphorylation of … 0000001985 00000 n
You can usually find your gene of interest in a genomic database. It will be invaluable to all researchers who wish to use the approaches for studies of gene function in cells or mice." 0000001261 00000 n
TurboKnockout ® gene targeting eliminates the unpredictability of germline transmission (GLT) with a super competent ESC line that generates 100% ESC-derived founder mice rather than chimeras. 0000003801 00000 n
0000005982 00000 n
Professor. Encyclopedia.com. Dr. franklin. 13 Jan. 2021 . Transcript and Presenter's Notes. Gene targeting would be used to replace the defective genes in selected somatic cells in culture, and their nuclei could then be transferred into stem cells. If two chromosomes break and come together again, some genes carried by these chromosomes are exchanged, a process called crossing over. 0000015409 00000 n
For conditional knockouts, it may be possible to breed founders directly to your … 0000011534 00000 n
Gene-targeting strategies for generating null or conditional mutant alleles: a. In this case, a reciprocal exchange of genetic … <<6D7C31A5067512439BAF506CC11D4F98>]>>
Gene targeting via homologous recombination provides a powerful means for studying gene function by a reverse genetic approach [1, 2].This technology depends on homologous recombination reactions that occur between transfected DNA (i.e., targeting vector) and the host genome [3, 4].In mammalian cells, however, this type of homologous … In addition t… genetic switches and for speeding the creation of gene-modi-the transgene is designed either to express a novel fied animals, is the Cre site-specific DNA recombinase of gene product or to misexpress a normal gene. NOTES 2759 TABLE 1. The technology allowed unprecedented precision with which one could manipulate genes and study the effect of this manipulation on the central nervous system. It is also possible to replace only a part of a gene, such as one portion of its protein coding region. Buy Gene Targeting: A Practical Approach: 212 (Practical Approach Series) 2 by Joyner, Alexandra L. (ISBN: 9780199637928) from Amazon's Book Store. With the target gene rendered inactive, scientists are able to deduce and investigate its biological functions in the mouse. gene targeting protocols methods in molecular biology Oct 27, 2020 Posted By Beatrix Potter Public Library TEXT ID 8539a247 Online PDF Ebook Epub Library making it possible to compare cells or individuals that are genetically identical except for a single well defined mutation in an endogenous gene these modified cells can be studied both in vitro and in vivo gene correction … Once a clone of ES cells with the correct targeting event has been identified, these cells can be used to introduced into the mouse via the process of blastocyst injection, which allows the study of gene function in the bodies of living, intact animals. Gene targeting procedures enable the precise (site-specific) introduction of a mutation to one of the estimated 100,000 murine genes. Researchers hope one day to use…, RNA interference is a process in which translation of some of a cell's messenger RNA (mRNA) sequences is prevented, because of the presence of (and c…, knockout A technique for inactivating a particular gene or genes within an organism or cell. gene somewhere into the mouse genome (i.e., the introduction of a “transgene”). :=�e&��eg&�L�4E���˄O�4/mM�ڪ��Q�". However, the date of retrieval is often important. (d) Summary of genotyping results of all T 0 events analysed. Targeting Construct Select for the NeoR gene and against the TKHSV gene The only cells to survive have undergone a targeted homologous recombination event at the gene of interest Select fot the genetically altered cells … This allows researchers to examine the function of a gene in a variety of ways. PLEASE NOTE: The mouse sequence in these databases is from a C57BL/6J mouse because this is the mouse strain whose genome was sequenced. The development of nuclear transfer technology also has opened up the possible alternative method of using homologous recombination for gene therapy based on cell transfer. A translational bottleneck to using reporter genes is the … "Gene Targeting More recently, Cas9 nuclea… Gene targeting overcomes the resistance of brain cancer to therapy by McGill University Gliobastoma (astrocytoma) WHO grade IV - MRI coronal view, post contrast. Select Your Cookie Preferences. Imaging reporter genes provides longitudinal information on the biodistribution, growth, and survival of engineered cells in vivo. Other methods of mutating the mouse genome include chemical mutagenesis, insertion of viral vectors or transposons, and random integration of gene-trap or promoter-trap vectors. ." The genetic recombination (or gene) refers to exchange genes between two nucleic acid molecules, to form new combinations of genes on a chromosome . 0000003351 00000 n
0000003501 00000 n
Therefore, that information is unavailable for most Encyclopedia.com content. 706 0 obj <>
endobj
Gene targeting can be permanent or conditional. The genetic recombination (or gene) refers to exchange genes between two nucleic acid molecules, to form new combinations of genes on a chromosome . Gene targeting can result from homologous recombination between an introduced DNA molecule and the homologous genomic locus. The simplest strategy is to include an antibiotic resistance gene on the vector, which interrupts the sequence homologous to the gene of interest and thus makes the inserted gene nonfunctional. Course. Conditions can be a specific … 0000010752 00000 n
The ability to target DNA constructs to particular locations in chromosomes is a very powerful tool because it allows the modification of more or less any gene of interest, in more or less any way desired. Psychology. J.-M Buerstedde, S TakedaIncreased ratio of gene targeted to random integration after … Mol Cell Biol, 12 (1992), pp. Gene Targeting With γ-Ray or X-Ray Radiation Using ZFNs, TALENs, or the CRISPR/Cas9 System. Gene-targeting efficiency in the land plant Physcomitrella patens (Bryophyta) can only be compared with that observed in Saccharomyces cerevisiae.Sequencing programs and microbiological … The other involves precisely targeting a specific gene in the mouse and introducing a know alteration of that gene, usually the deletion of the gene and the insertion of a marker gene in its place (a gene … A successful gene-targeting event using a bipartite gene-targeting substrate requires that three HR events take place. To perform homologous recombination in the laboratory, one must generate and isolate DNA fragments be… For example, tall, brown-eyed parents tend to have tall, brown-eyed…, Gene Robinson Becomes First Openly Gay Episcopal Bishop, https://www.encyclopedia.com/medicine/medical-magazines/gene-targeting. 0000015285 00000 n
In addition, sequences on either side of the target should be identical, to promote more efficient targeting and recombination. Gene targeting is a method for modifying the structure of a specific gene without removing it from its natural environment in the chromosome in a living cell. For example, it is possible to examine where in the animal the gene is normally expressed by insertion (knock-in) of a fluorescent protein (such as green fluorescent protein, GFP) into the gene so that the cells expressing the gene begin to glow.